SGN Marker C2_At1g28530

SGN-M6736
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204744---
Lycopersicon CombinedSingleSGN-U231899---
ArabidopsisSingleAt1g28530 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46575)
Chromosome
9
Position
66.30 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42178)
Chromosome
3
Position
16.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43742
Forward primer (5'-3')
GCTCTTTACATGCCTGCTTTATTTAAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGATTGCTTTTGACATAGAAATGCTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41320)
Chromosome
4
Position
24.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43296
Forward primer (5'-3')
GCAATCTCTATGGTCCTTGCAAGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGATAAAATGATATCAACTAAAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38151)
Chromosome
3
Position
21.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41072
Forward primer (5'-3')
ATTATGAAGATGTCTATACACTTCCCTAC
Accessions and product sizes
Solanum lycopersicum TA209
410
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGATTGCTTTTGACATAGAAATGCTT
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
410
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25141)
Chromosome
1
Position
10.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g28530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6736 marker 6736
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)