SGN Marker C2_At1g29900

SGN-M6747
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303686 (SGN)
121342 (CGN)
---
Solanum tuberosumSingleSGN-U262443---
ArabidopsisSingleAt1g29900 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38156)
Chromosome
6
Position
80.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39439
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150+250
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25152)
Chromosome
1
Position
10.47 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10143
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10144
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10145
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32210
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10146
Forward primer (5'-3')
TGATACATGTGCTGCAAATTTGAGGC
Digested band sizes (using HhaI)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTTCAATGGGGTTTGACCTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII,CfoI/HhaI,HinfI,Hpy188I,SsPI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI,XmnI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g29900F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g29900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6747 marker 6747
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)