SGN Marker C2_At1g29990

SGN-M6749
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302861 (SGN)
124626 (CGN)
---
Capsicum annuumSingleSGN-U196768---
Lycopersicon CombinedSingleSGN-U220203---
Solanum tuberosumSingleSGN-U266100---
ArabidopsisSingleAt1g29990 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38158)
Chromosome
8
Position
20.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39440
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
Accessions and product sizes
Solanum lycopersicum TA209
100
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25154)
Chromosome
1
Position
10.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10147
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10148
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 10149
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 12560
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12561
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12562
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12563
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12564
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12565
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12566
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12567
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12568
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12569
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12570
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 32745
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 32746
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 32747
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 32748
Forward primer (5'-3')
TTGGTGAAAACGAGCTTGTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAACATTGGCGTCTTCATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g29990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6749 marker 6749
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)