SGN Marker C2_At1g30540

SGN-M6757
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200474---
Solanum tuberosumSingleSGN-U251878---
ArabidopsisSingleAt1g30540 on TAIR---
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47142)
Chromosome
2
Position
3.10 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46578)
Chromosome
2
Position
52.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46437)
Chromosome
2
Position
106.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41322)
Chromosome
2
Position
11.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43298
Forward primer (5'-3')
AATAGGTCAATTAATCAGAAGCAGAAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ACCCAAACAAATCGCTTGAACAGCTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38162)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39444
Forward primer (5'-3')
ATTGCAAGGTGATGTTGGGTGTAGATGG
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
ACCCAAACAAATCGCTTGAACAGCTGA
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25162)
Chromosome
1
Position
10.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g30540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6757 marker 6757
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)