SGN Marker C2_At1g30755

SGN-M6759
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304818 (SGN)
121212 (CGN)
---
Solanum tuberosumSingleSGN-U248826---
ArabidopsisSingleAt1g30755 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38164)
Chromosome
4
Position
131.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39446
Forward primer (5'-3')
AGATTAAAGCAGAGATGGAAAAAAC
Accessions and product sizes
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCTCCAACCCATCCAAAGCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25165)
Chromosome
1
Position
10.91 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g30755  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6759 marker 6759
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)