SGN Marker C2_At1g31410

SGN-M6763
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301758 (SGN)
124859 (CGN)
---
Lycopersicon CombinedSingleSGN-U225446---
Solanum tuberosumSingleSGN-U265330---
ArabidopsisSingleAt1g31410 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46439)
Chromosome
10
Position
70.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41323)
Chromosome
8
Position
4.20 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43299
Forward primer (5'-3')
AGAGTGAAATTACGTTCTGAGTTTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTAAGCTATAACTATGCTTCCCCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38166)
Chromosome
8
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39448
Forward primer (5'-3')
AGAGTGAAATTACGTTCTGAGTTTCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTAAGCTATAACTATGCTTCCCCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25169)
Chromosome
1
Position
11.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g31410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6763 marker 6763
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)