SGN Marker C2_At1g32220

SGN-M6776
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309033 (SGN)
128663 (CGN)
---
Capsicum annuumSingleSGN-U204835---
Lycopersicon CombinedMultipleSGN-U216186---
Solanum tuberosumSingleSGN-U248166---
ArabidopsisSingleAt1g32220 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38168)
Chromosome
8
Position
49.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41082
Forward primer (5'-3')
ACCCCTAAGTTCATATTGATTTCTGTGC
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTCCCATATATAAAGGCAGGTCTAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25182)
Chromosome
1
Position
11.61 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g32220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6776 marker 6776
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)