SGN Marker C2_At1g32410

SGN-M6778
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308727 (SGN)
127796 (CGN)
---
Solanum tuberosumSingleSGN-U267846---
ArabidopsisSingleAt1g32410 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46581)
Chromosome
8
Position
66.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41324)
Chromosome
1
Position
57.30 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43300
Forward primer (5'-3')
TGTTAGTGTCTGGAGGGATTGTATTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGATTCGGTGTAGAGACTGGAAGTATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38169)
Chromosome
8
Position
52.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39450
Forward primer (5'-3')
TGTTAGTGTCTGGAGGGATTGTATTG
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
AGATTCGGTGTAGAGACTGGAAGTATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25184)
Chromosome
1
Position
11.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g32410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6778 marker 6778
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)