SGN Marker C2_At1g32900

SGN-M6783
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299968 (SGN)
121761 (CGN)
---
Capsicum annuumSingleSGN-U198362---
Lycopersicon CombinedSingleSGN-U218165---
Solanum tuberosumMultipleSGN-U243360---
ArabidopsisSingleAt1g32900 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41325)
Chromosome
1
Position
13.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43301
Forward primer (5'-3')
TCTGCATCCATAACATTGCCTACC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTTATGCTTGGAATCAGACCACCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38170)
Chromosome
8
Position
87.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39451
Forward primer (5'-3')
TCTGCATCCATAACATTGCCTACC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATTGTAATATCCCAGCCTTCATCCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25189)
Chromosome
1
Position
11.92 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 42607
Forward primer (5'-3')
TCTGCATCCATAACATTGCCTACC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTTATGCTTGGAATCAGACCACCAGC
Enzymes
  
Accessions and product sizes
Approximate temperature
58°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g32900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6783 marker 6783
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)