SGN Marker C2_At1g36320

SGN-M6795
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303649 (SGN)
125083 (CGN)
---
Lycopersicon CombinedSingleSGN-U224420---
ArabidopsisSingleAt1g36320 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25201)
Chromosome
1
Position
13.67 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41086
Forward primer (5'-3')
TGGTAGCTGTGGAGGTTTATGATACTG
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
TACATCTTCCCCTTCAAGTTCTTCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10184
Forward primer (5'-3')
TGGTAGCTGTGGAGGTTTATGATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACATCTTCCCCTTCAAGTTCTTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 10185
Forward primer (5'-3')
TGGTAGCTGTGGAGGTTTATGATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACATCTTCCCCTTCAAGTTCTTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 10186
Forward primer (5'-3')
TGGTAGCTGTGGAGGTTTATGATACTG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TACATCTTCCCCTTCAAGTTCTTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32213
Forward primer (5'-3')
TGGTAGCTGTGGAGGTTTATGATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACATCTTCCCCTTCAAGTTCTTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g36320F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g36320  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6795 marker 6795
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)