SGN Marker C2_At1g42990

SGN-M6799
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197083---
Lycopersicon CombinedSingleSGN-U213210---
Solanum tuberosumSingleSGN-U245078---
ArabidopsisSingleAt1g42990 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132177)
Chromosome
4
Position
119.48 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46584)
Chromosome
4
Position
94.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41327)
Chromosome
4
Position
147.20 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43303
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38176)
Chromosome
4
Position
135.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39457
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
100+150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25205)
Chromosome
1
Position
16.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10187
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10188
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10189
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12193
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12194
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 700+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12195
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12196
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12197
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12198
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12199
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 850+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12200
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12597
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 12598
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12599
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12600
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12601
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12602
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12603
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12604
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12605
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12606
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12607
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32758
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32759
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32760
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32761
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33317
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 33318
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 33319
Forward primer (5'-3')
ACATCAACTGGGACGATGTAGATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCACGGCAGACTCCTGCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10190
Forward primer (5'-3')
ATGACCCCGTCGATAAGAAGCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCACAGCTGCATCTCTATTCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g42990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6799 marker 6799
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)