SGN Marker C2_At1g43580

SGN-M6801
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311875 (SGN)
125562 (CGN)
---
Solanum tuberosumSingleSGN-U257864---
ArabidopsisSingleAt1g43580 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132178)
Chromosome
4
Position
62.18 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38177)
Chromosome
4
Position
72.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39458
Forward primer (5'-3')
TCGCAATGATTTTTTTGCTCTCTGC
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1400
Approximate temperature
55°C
Reverse primer (5'-3')
AGCACCAACCACTGACCAACATCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25207)
Chromosome
1
Position
16.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g43580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6801 marker 6801
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)