SGN Marker C2_At1g44446

SGN-M6806
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300289 (SGN)
122358 (CGN)
---
Capsicum annuumSingleSGN-U197756---
Lycopersicon CombinedMultipleSGN-U220686---
Solanum tuberosumSingleSGN-U256856---
ArabidopsisSingleAt1g44446 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132179)
Chromosome
6
Position
70.83 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38178)
Chromosome
11
Position
40.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39459
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
Accessions and product sizes
Solanum lycopersicum TA209
100
Solanum pennellii TA56
100
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25212)
Chromosome
1
Position
16.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10199
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10200
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10201
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12608
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12609
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 900+300
Approximate temperature
55°C
  
PCR data   Exp. ID 12610
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400+300
Approximate temperature
55°C
  
PCR data   Exp. ID 12611
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12612
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12613
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12614
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12615
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12616
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12617
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 350+750
Approximate temperature
55°C
  
PCR data   Exp. ID 12618
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 700+300
Approximate temperature
55°C
  
PCR data   Exp. ID 12619
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12620
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12621
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32762
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32763
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32764
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32765
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10202
Forward primer (5'-3')
AGATCTTGCACACGCACCTTTCAC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCAGACCAGATGCAGGAGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g44446  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6806 marker 6806
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)