SGN Marker C2_At1g44790

SGN-M6807
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202035---
Lycopersicon CombinedSingleSGN-U228323---
Solanum tuberosumSingleSGN-U248006---
ArabidopsisSingleAt1g44790 on TAIR---
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53426)
Chromosome
11
Position
32.95 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46586)
Chromosome
4
Position
43.80 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38181)
Chromosome
11
Position
40.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39462
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25215)
Chromosome
1
Position
16.92 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10211
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10212
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10213
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12648
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12649
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12650
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12651
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 650+250
Approximate temperature
55°C
  
PCR data   Exp. ID 12652
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12653
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12654
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12655
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12656
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12657
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 12658
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 12659
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12660
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 32774
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32775
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 650+250
Approximate temperature
55°C
  
PCR data   Exp. ID 32776
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32777
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10214
Forward primer (5'-3')
TCGGTTTTATCAAAGGCTATCGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTACTGTTCTACCTGGGAATTCTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g44790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6807 marker 6807
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)