Sol Genomics Network

SGN Marker C2_At1g44790

SGN-M6807
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Capsicum annuum	Single	SGN-U202035	-	-	-
Lycopersicon Combined	Single	SGN-U228323	-	-	-
Solanum tuberosum	Single	SGN-U248006	-	-	-
Arabidopsis	Single	At1g44790 on TAIR	-	-	-

Mapped locations

Map: Tomato-EXPIMP 2009
Map version 126 (location: 53426)
Chromosome 11
Position 32.95 cM
Confidence uncalculated
Protocol CAPS

Tomato-EXPIMP 2009

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46586)
Chromosome 4
Position 43.80 cM
Confidence I(LOD2)
Protocol PCR

Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000
Map version 52 (location: 38181)
Chromosome 11
Position 40.50 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39462

Forward primer (5'-3')

TCGGTTTTATCAAAGGCTATCGTC

Accessions and product sizes

Solanum lycopersicum TA209

250

Solanum pennellii TA56

250

Approximate temperature

55°C

Reverse primer (5'-3')

TGTTACTGTTCTACCTGGGAATTCTGG

Digested band sizes (using amplicon difference)

Solanum lycopersicum TA209

200

Solanum pennellii TA56

250

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 25215)
Chromosome 1
Position 16.92 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 10211
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 250	Approximate temperature 55°C

PCR data Exp. ID 10212
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 300	Approximate temperature 55°C

PCR data Exp. ID 10213
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 300	Approximate temperature 55°C

PCR data Exp. ID 12648
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Solanum tuberosum TA3427: 350	Approximate temperature 55°C

PCR data Exp. ID 12649
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Capsicum annuum TA3428: 400	Approximate temperature 55°C

PCR data Exp. ID 12650
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3346: 700	Approximate temperature 55°C

PCR data Exp. ID 12651
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3347: 250+650	Approximate temperature 55°C

PCR data Exp. ID 12652
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana tomentosiformis TA3349: 400	Approximate temperature 55°C

PCR data Exp. ID 12653
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana otophora TA3350: 350	Approximate temperature 55°C

PCR data Exp. ID 12654
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana plumbaginifolia TA3354: 450	Approximate temperature 55°C

PCR data Exp. ID 12655
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Physalis TA1367: 320	Approximate temperature 55°C

PCR data Exp. ID 12656
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Petunia axillaris TA3309: 500	Approximate temperature 55°C

PCR data Exp. ID 12657
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Petunia axillaris subsp. parodii TA3310: 430	Approximate temperature 55°C

PCR data Exp. ID 12658
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Petunia x hybrida TA3311: 430	Approximate temperature 55°C

PCR data Exp. ID 12659
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Petunia integrifolia TA3312: 500	Approximate temperature 55°C

PCR data Exp. ID 12660
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Coffea canephora BP409: 150	Approximate temperature 55°C

PCR data Exp. ID 32774
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3346: 700	Approximate temperature 55°C

PCR data Exp. ID 32775
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3347: 250+650	Approximate temperature 55°C

PCR data Exp. ID 32776
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana tomentosiformis TA3349: 400	Approximate temperature 55°C

PCR data Exp. ID 32777
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes
Accessions and product sizes Nicotiana otophora TA3350: 350	Approximate temperature 55°C

PCR data Exp. ID 10214
Forward primer (5'-3') TCGGTTTTATCAAAGGCTATCGTC	Digested band sizes (using amplicon difference) Solanum pennellii LA716: 250 Solanum lycopersicum LA925: 300	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGTTACTGTTCTACCTGGGAATTCTGG	Enzymes All possible enzymes for pennellii and and lycopersicum: amplicon difference
Accessions and product sizes Solanum pennellii LA716: 250 Solanum lycopersicum LA925: 300	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U228323

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

BLASTX result of original unigene sequences against Arabidopsis protein database

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At1g44790

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6807 marker 6807

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: