SGN Marker C2_At1g48300

SGN-M6824
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303773 (SGN)
122233 (CGN)
---
Capsicum annuumSingleSGN-U203252---
Solanum tuberosumSingleSGN-U246110---
ArabidopsisSingleAt1g48300 on TAIR---
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53427)
Chromosome
12
Position
77.25 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46588)
Chromosome
12
Position
72.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42184)
Chromosome
5
Position
113.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43748
Forward primer (5'-3')
TGGGACAGCTTCAACAGCTAAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TACACCCTGAAACTCTGACATTAGGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41330)
Chromosome
12
Position
113.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43306
Forward primer (5'-3')
TGGGACAGCTTCAACAGCTAAAGG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TACACCCTGAAACTCTGACATTAGGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38186)
Chromosome
12
Position
105.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39467
Forward primer (5'-3')
AAGAAGATGAAATTACTTAAGGGTTTG
Accessions and product sizes
Solanum pennellii TA56
520
Solanum lycopersicum TA209
520
Approximate temperature
55°C
Reverse primer (5'-3')
TTTAGTGTTGCATTCTCAAGTGCTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25232)
Chromosome
1
Position
17.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10228
Forward primer (5'-3')
AAGAAGATGAAATTACTTAAGGGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTGTTGCATTCTCAAGTGCTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10229
Forward primer (5'-3')
AAGAAGATGAAATTACTTAAGGGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTGTTGCATTCTCAAGTGCTCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10230
Forward primer (5'-3')
AAGAAGATGAAATTACTTAAGGGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTGTTGCATTCTCAAGTGCTCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10231
Forward primer (5'-3')
AAGAAGATGAAATTACTTAAGGGTTTG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 550
Solanum pennellii LA716: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAGTGTTGCATTCTCAAGTGCTCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,BamHI,BanI,BsaHI,BspDI,BstNI,BstUI,BstYI,DpnII,HindIII,HinfI,Hpy188I,RsaI,ScrFI
All possible enzymes for lycopersicum and pimpinellifolium: ApoI,BsiEI,BspDI,BstUI,CfoI/HhaI,DpnII,HindIII,Hpy188I,TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g48300F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g48300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6824 marker 6824
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)