SGN Marker C2_At1g49590

SGN-M6834
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202864---
Lycopersicon CombinedSingleSGN-U221449---
Solanum tuberosumSingleSGN-U249317---
ArabidopsisSingleAt1g49590 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25242)
Chromosome
1
Position
18.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41098
Forward primer (5'-3')
AGAGTTAAAAGAAGCAGCCCGTGC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCATGTCCTTATCATAGCTGCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10235
Forward primer (5'-3')
AGAGTTAAAAGAAGCAGCCCGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTCCTTATCATAGCTGCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10236
Forward primer (5'-3')
AGAGTTAAAAGAAGCAGCCCGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTCCTTATCATAGCTGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10237
Forward primer (5'-3')
AGAGTTAAAAGAAGCAGCCCGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTCCTTATCATAGCTGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g49590F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g49590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6834 marker 6834
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)