SGN Marker C2_At1g50020

SGN-M6839
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301729 (SGN)
123082 (CGN)
---
Lycopersicon CombinedSingleSGN-U227232---
Solanum tuberosumSingleSGN-U246704---
ArabidopsisSingleAt1g50020 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38189)
Chromosome
1
Position
146.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39469
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
550+650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25247)
Chromosome
1
Position
18.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10241
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10242
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10243
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12668
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12669
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12670
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32598
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32781
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32782
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32783
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10244
Forward primer (5'-3')
TTGCTTACTCTTGGTGGAACATTC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 550+650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTGTGATATCCTCTCTTCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g50020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6839 marker 6839
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)