Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR11

SGN-M684

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CAG   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: CCTTCAATTGACCTCCCTCA
Reverse primer: GCATCTGGAAATTAGAGGCG
Predicted size: 235
Derivations 
This marker was derived from EST read SGN-E120237
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39162)
Chromosome
3
Position
164.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 52
Forward primer (5'-3')
CCTTCAATTGACCTCCCTCA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCATCTGGAAATTAGAGGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 235+235
Solanum pennellii LA716: 228+235
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR11 was used as an overgo probe on plate 2 [well C3]

Plausible BAC Matches:   P295I12,   P046M03,   P159D05,   P107I20

 Non-Plausible BAC matches

P321F01,   P159C06,   P109E21,   P094F12

 Overgo Sequences

A sequence
GCACAATCGCCTTCAATTGACCTC
B sequence
CTAACGGGATTTGAGGGAGGTCAA
AB sequence
GCACAATCGCCTTCAATTGACCTCCCTCAA
Marker sequence
GCCTAAACTGAAAATTCAAAGTTTCCGATGACTCTGTTGAGCTGAATTCC
GTTCAGTCGACGAATCATCTTCATCGTCACAACACGAACCAATAAACAAA
TGGCTGAAATTCCGTCGTCTTCCCCAAAATTAACTCAACCATCGAACCCT
ATAATGGATACCACAAACCAAGTAACCGCCGGCGGAGCTGCACCGTCGAC
GACGTCGTCTAATCCCGGAATTACGATGACTTCTCCTTCTAACAACAATT
CAATCGCACAATCGCCTTCAATTGACCTCCCTCAAATCCCGTTAGCCCAA
TCTCAGCAACAGCAGCATCAGCATCAAATTCAGATGCCGCAACCTCAACA
AATGCAGCAGCAGCAGCAACAGCAATTGACACAATCTCAACAACAGCAGC
AGCAGCAGCAGCAAATGCAGCTCCAGCAGCAACAGAGTAATTCGAGCAAT
CTTAACGGCAGTAACAGCAACTTGATGTCCGCCTCTAATTTCCAGATGCA
GCAAAACTTGCAGAGATCGCCCTCAATGGCGGCGAGGATGAGTCAATTGC
AAATGCAACAGCAGC
Genomic location of SSR11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D684 marker 684
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)