SGN Marker C2_At1g51160

SGN-M6846
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307274 (SGN)
128469 (CGN)
---
Lycopersicon CombinedSingleSGN-U224053---
Solanum tuberosumSingleSGN-U253994---
ArabidopsisSingleAt1g51160 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49213)
Chromosome
3
Position
2.21 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47144)
Chromosome
3
Position
40.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46589)
Chromosome
3
Position
45.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46442)
Chromosome
3
Position
45.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42185)
Chromosome
3
Position
67.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43749
Forward primer (5'-3')
TCTTCGGAGGATCAGAGATCAGTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CATTATGTCTTTGAAATTAGTCATAACCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41331)
Chromosome
3
Position
75.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43307
Forward primer (5'-3')
TCTTCGGAGGATCAGAGATCAGTCC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AACGAACATCCTTGTCCAGGTAATTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38192)
Chromosome
3
Position
47.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39471
Forward primer (5'-3')
TCTTCGGAGGATCAGAGATCAGTCC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
300
Approximate temperature
55°C
Reverse primer (5'-3')
AACGAACATCCTTGTCCAGGTAATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
175
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25254)
Chromosome
1
Position
18.95 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g51160  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6846 marker 6846
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)