SGN Marker C2_At1g51350

SGN-M6847
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303450 (SGN)
123736 (CGN)
---
Lycopersicon CombinedSingleSGN-U227427---
ArabidopsisSingleAt1g51350 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49214)
Chromosome
11
Position
48.43 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47145)
Chromosome
11
Position
74.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41332)
Chromosome
11
Position
63.50 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43308
Forward primer (5'-3')
TCTAGATTCTATCCAGCATGTCTTTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATTATCTTAAATTCTTCACCTATTAAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38193)
Chromosome
11
Position
57.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41103
Forward primer (5'-3')
TCTAGATTCTATCCAGCATGTCTTTGC
Accessions and product sizes
Solanum pennellii TA56
600
Solanum lycopersicum TA209
600
Approximate temperature
55°C
Reverse primer (5'-3')
AACTGCTTGGAAAAGTAAGATTTACTA
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25255)
Chromosome
1
Position
19.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g51350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6847 marker 6847
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)