SGN Marker SSR13

SGN-M686

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 42.857 High: 44
Repeat motif: AAG   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: GGGTCACATACACTCATACTAAGGA
Reverse primer: CAAATCGCGACATGTGTAAGA
Predicted size: 104
Derivations 
This marker was derived from EST read SGN-E120028
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39172)
Chromosome
5
Position
28.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 69
Forward primer (5'-3')
GGGTCACATACACTCATACTAAGGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAAATCGCGACATGTGTAAGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 97+102
Solanum lycopersicum LA925: 102+102
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR13 was used as an overgo probe on plate 11 [well B12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACCACCAAGTGGCTATGATTGCC
B sequence
GAATAAGGAGGTGGAGGGCAATCA
AB sequence
AACCACCAAGTGGCTATGATTGCCCTCCAC
Marker sequence
CACTTTTCATTTCTTACAAGTTAACATACTATATGGGGTCACATACACTC
ATACTAAGGAAGAAAAAAGAAGAAGAAGAAGAAGAAATTCACATTCAAAA
GGTTTTCACAAGCAAATCTCTTACACATGTCGCGATTTGTGATTTTTCTC
TTATTTTTTGTGGTGGCTATACCTATAACCAATGGACTAAACCAACGAAA
ACTCGATGAGGGTGAAAATAAATGTGGAGGTTGTCCTTGTAACAAACCTT
GTATTCCACCTTCTCCTCCACCACCACCACCGTCATCACCGCCGCCGCCG
CCGCCAAAGAAACCACCAAGTGGCTATGATTGCCCTCCACCTCCTTATTC
CGGTGGCGGCGGCGGTGGAGGTGGTGGTGGTTCAAATATTCCCTATCCTC
CAAATTCACAATACATATATATGACTGGTCCACCTGGCAATTTGTACCCC
GTTGACCATGATTTTGGTGGTGCAAAAAGAAGCTTTTCTAGTGGATTTTC
ACTTTTAATTGGTGGATTTTTCTTGGGATTGTTTTATTTTTGGTGAAATT
CAACATCAAATCAAATAAGAGGAAGAAGCAGCAAATTTAAG
Genomic location of SSR13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D686 marker 686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)