Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR14

SGN-M687

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: ATA   Repeat number: 9
Repeat motif:    Repeat number:
Forward primer: TCTGCATCTGGTGAAGCAAG
Reverse primer: CTGGATTGCCTGGTTGATTT
Predicted size: 166
Derivations 
This marker was derived from EST read SGN-E120083
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43782)
Chromosome
3
Position
108.70 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44782
Forward primer (5'-3')
TCTGCATCTGGTGAAGCAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTGGATTGCCTGGTTGATTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43242)
Chromosome
3
Position
99.10 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44596
Forward primer (5'-3')
TCTGCATCTGGTGAAGCAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTGGATTGCCTGGTTGATTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40760)
Chromosome
3
Position
112.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39176)
Chromosome
3
Position
162.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 51
Forward primer (5'-3')
TCTGCATCTGGTGAAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTGGATTGCCTGGTTGATTT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 166+166
Solanum pennellii LA716: 158+166
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR14 was used as an overgo probe on plate 2 [well E5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCCTTTTTGGGACCAATCATGTGG
B sequence
GCTTCTGGGTCTGTTACCACATGA
AB sequence
CCCTTTTTGGGACCAATCATGTGGTAACAG
Marker sequence
GAATCAGTTGGTAGATTAGCTTGAAGAGGGAGACGAAAGAGATCAAGATT
GTGATGATGAAAGATTTAATGAATCAACAAGCTCAAGTACCTGGTGTTGT
TATGGAGGAGAACATGTCCAATTTAACTTCTGCATCTGGTGAAGCAAGTG
TATCTTCTTCGAACCGAAATGATAATAATAATAATAATAATAATAATATT
TATCCTCATCATCAGTATAACTTTGCTCCTCCAAATCAACAAACTCAACC
TGCACAACAAATCAAGAAGAAGAGAAATCAACCAGGCAATCCAGGTTTGA
ATTCAAAGCTTTTTGAAGTACTTTTGTTATATGCTTTTTTTTGGGTTATG
AAATCCTTTCAACTTTTTCTTTTCCCCTTTTTGGGACCAATCATGTGGTA
ACAGACCCAGAAGCTGAAGTGATAGCTTTGTCACCAAAGACACTAATGGC
AACCAATAGATTTGTTTGTGAAATCTGTAACAAAGGATTTCAAAGAGATC
AGAACCTGCAGCTTCACAGAAGAGGACACAACTTGCCATGGAAGCTCAAG
CAAAGAACAAGCAAAGAAATAAGAAAAAAAGTGTATGTTTGCCCAGAAAC
TAGCTGTGTTCATCATGACCCAGCAAGAGCTCTGGGAGATCTCACTGGAA
TC
Genomic location of SSR14  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D687 marker 687
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)