SGN Marker C2_At1g54520

SGN-M6872
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304188 (SGN)
119508 (CGN)
---
Lycopersicon CombinedSingleSGN-U225124---
Solanum tuberosumMultipleSGN-U246617---
ArabidopsisSingleAt1g54520 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46592)
Chromosome
1
Position
49.40 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46444)
Chromosome
1
Position
32.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38205)
Chromosome
1
Position
101.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41108
Forward primer (5'-3')
TGGAGGAAGGCGAGAATCGATTCAA
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
58°C
Reverse primer (5'-3')
AGGCAATTTATAAACACCTTCAGCAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
650
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25281)
Chromosome
1
Position
20.37 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g54520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6872 marker 6872
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)