SGN Marker C2_At1g55480

SGN-M6882
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301344 (SGN)
120291 (CGN)
---
Lycopersicon CombinedSingleSGN-U216749---
Solanum tuberosumSingleSGN-U251181---
ArabidopsisSingleAt1g55480 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25292)
Chromosome
1
Position
20.72 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41115
Forward primer (5'-3')
AGAGAAAGAGAACTTCGCGAAGG
Accessions and product sizes
Solanum pennellii TA56
530
Solanum lycopersicum TA209
530
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTTGGAATAACAACATGCAACATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
530
Solanum pennellii TA56
340
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10279
Forward primer (5'-3')
AGAGAAAGAGAACTTCGCGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGAATAACAACATGCAACATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 230
Approximate temperature
55°C
  
PCR data   Exp. ID 10280
Forward primer (5'-3')
AGAGAAAGAGAACTTCGCGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGAATAACAACATGCAACATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 230
Approximate temperature
55°C
  
PCR data   Exp. ID 10281
Forward primer (5'-3')
AGAGAAAGAGAACTTCGCGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGAATAACAACATGCAACATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 230
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g55480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6882 marker 6882
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)