SGN Marker C2_At1g55670

SGN-M6884
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300459 (SGN)
122622 (CGN)
---
Capsicum annuumSingleSGN-U197380---
Lycopersicon CombinedSingleSGN-U225170---
Solanum tuberosumSingleSGN-U245521---
ArabidopsisSingleAt1g55670 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49216)
Chromosome
7
Position
64.87 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47147)
Chromosome
7
Position
102.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42187)
Chromosome
7
Position
110.20 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43751
Forward primer (5'-3')
AACAAACCAATCTCCTTCAAACCCAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41334)
Chromosome
7
Position
110.60 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43310
Forward primer (5'-3')
TTTTCAATTTCCAAGAGAGAAAATAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38207)
Chromosome
7
Position
110.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39482
Forward primer (5'-3')
TCCGTTGTCATCAGTTTGAGCACTGG
Accessions and product sizes
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1600
Approximate temperature
55°C
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25294)
Chromosome
1
Position
20.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32217
Forward primer (5'-3')
TCCGTTGTCATCAGTTTGAGCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
53°C
  
PCR data   Exp. ID 32218
Forward primer (5'-3')
TCCGTTGTCATCAGTTTGAGCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
53°C
  
PCR data   Exp. ID 32219
Forward primer (5'-3')
TCCGTTGTCATCAGTTTGAGCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCATATCCATTGCTAGAAGTAGCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g55670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6884 marker 6884
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)