SGN Marker C2_At1g55840

SGN-M6886
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302634 (SGN)
121043 (CGN)
---
Capsicum annuumSingleSGN-U200408---
Lycopersicon CombinedMultipleSGN-U217356---
Solanum tuberosumSingleSGN-U246421---
ArabidopsisSingleAt1g55840 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46593)
Chromosome
7
Position
46.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38208)
Chromosome
7
Position
92.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39483
Forward primer (5'-3')
TATATTCAATCACATATCCAAATGAATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACAATGTAATATGTATCTGTCTTCTCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25296)
Chromosome
1
Position
20.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g55840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6886 marker 6886
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)