SGN Marker C2_At1g55880

SGN-M6888
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312097 (SGN)
125435 (CGN)
---
Lycopersicon CombinedSingleSGN-U229257---
Solanum tuberosumSingleSGN-U250772---
ArabidopsisSingleAt1g55880 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41335)
Chromosome
7
Position
109.40 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43311
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38210)
Chromosome
7
Position
89.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39485
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
410
Solanum lycopersicum TA209
480
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25298)
Chromosome
1
Position
20.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10286
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 10287
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 10288
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 10289
Forward primer (5'-3')
AGAAGGCTGAAGAACCCGTTTGATAC
Digested band sizes (using Tsp509I)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 380
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCCAGACCAGTTGCTGAAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: Hpy188I,Tsp509I
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Solanum pennellii LA716: 580
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g55880F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g55880F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text

Genomic location of C2_At1g55880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6888 marker 6888
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)