SGN Marker C2_At1g56050

SGN-M6891
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308896 (SGN)
128039 (CGN)
---
Lycopersicon CombinedMultipleSGN-U215879---
Solanum tuberosumSingleSGN-U250228---
ArabidopsisSingleAt1g56050 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46594)
Chromosome
11
Position
42.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46445)
Chromosome
11
Position
31.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42189)
Chromosome
7
Position
115.00 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43753
Forward primer (5'-3')
TCTCCTAGGGTTGCGTACATACTTCAC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
TGCCCTGATGAAGCCCTTTTCAAAGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38211)
Chromosome
7
Position
100.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39486
Forward primer (5'-3')
TCTCCTAGGGTTGCGTACATACTTCAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCCCTGATGAAGCCCTTTTCAAAGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25301)
Chromosome
1
Position
20.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g56050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6891 marker 6891
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)