SGN Marker C2_At1g56700

SGN-M6899
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300167 (SGN)
122644 (CGN)
---
Capsicum annuumMultipleSGN-U199300---
Lycopersicon CombinedMultipleSGN-U239993---
Solanum tuberosumSingleSGN-U244030---
ArabidopsisSingleAt1g56700 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38215)
Chromosome
1
Position
116.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41121
Forward primer (5'-3')
AAAGTCCCTATTGTTCCTGCAGATGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GTCATTTCCTCCACCGGAAGAGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25309)
Chromosome
1
Position
21.26 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10300
Forward primer (5'-3')
TGCCCAAAGGGGTAATCCTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGAGGCTTCCACCCCATCTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
Unknown
  
PCR data   Exp. ID 10301
Forward primer (5'-3')
TGCCCAAAGGGGTAATCCTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGAGGCTTCCACCCCATCTCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
Unknown
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g56700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6899 marker 6899
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)