SGN Marker C2_At1g63610

SGN-M6935
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307607 (SGN)
127751 (CGN)
---
Lycopersicon CombinedSingleSGN-U219754---
ArabidopsisSingleAt1g63610 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41339)
Chromosome
4
Position
142.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43315
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38226)
Chromosome
4
Position
132.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39498
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25347)
Chromosome
1
Position
23.59 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10328
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10329
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10330
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32222
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10331
Forward primer (5'-3')
TGATGACTGGATATATGTTTAGGAATGC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGATTCAATTCCTCCACTTCTGCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,ApoI,BstNI,HinfI,ScrFI,XcmI
All possible enzymes for lycopersicum and pimpinellifolium: AluI,ApoI,BstNI,ScrFI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g63610F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g63610  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6935 marker 6935
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)