SGN Marker C2_At1g63980

SGN-M6940
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301269 (SGN)
122209 (CGN)
---
Lycopersicon CombinedMultipleSGN-U212644---
Solanum tuberosumSingleSGN-U245770---
ArabidopsisSingleAt1g63980 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41340)
Chromosome
1
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43316
Forward primer (5'-3')
TGATTTAATCATTGTCATTTTAGTTCTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAGCATTTACAAGCGTATACGAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38228)
Chromosome
8
Position
77.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39500
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
Accessions and product sizes
Solanum lycopersicum TA209
1650
Solanum pennellii TA56
1650
Approximate temperature
50°C
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
670
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25353)
Chromosome
1
Position
23.75 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10339
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 10340
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 10341
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 12769
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12770
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12771
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12772
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12773
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12774
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12775
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12776
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12777
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32606
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32829
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32830
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32831
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32832
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32833
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10342
Forward primer (5'-3')
AGAAAGTCTGCCGCCTTCCG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 670
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGCCTTCTCCTTCTTCCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, MspI, DraI, EcoRV, HaeIII, HinfI, DpnII, KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
50°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g63980  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6940 marker 6940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)