SGN Marker C2_At1g64355

SGN-M6942
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311456 (SGN)
129420 (CGN)
---
Lycopersicon CombinedSingleSGN-U224379---
Solanum tuberosumSingleSGN-U252178---
ArabidopsisSingleAt1g64355 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38230)
Chromosome
8
Position
6.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39502
Forward primer (5'-3')
AGAATTGTGTGTGGGTTTTTGCCAG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCAGCTCCTCCATGCAACCAATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25355)
Chromosome
1
Position
23.89 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10343
Forward primer (5'-3')
AGAATTGTGTGTGGGTTTTTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCAGCTCCTCCATGCAACCAATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 920+1850
Approximate temperature
55°C
  
PCR data   Exp. ID 10344
Forward primer (5'-3')
AGAATTGTGTGTGGGTTTTTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCAGCTCCTCCATGCAACCAATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 920+1850
Approximate temperature
55°C
  
PCR data   Exp. ID 10345
Forward primer (5'-3')
AGAATTGTGTGTGGGTTTTTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCAGCTCCTCCATGCAACCAATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 920+1850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g64355  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6942 marker 6942
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)