SGN Marker C2_At1g64660

SGN-M6950
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311195 (SGN)
128069 (CGN)
---
Capsicum annuumSingleSGN-U196127---
Solanum tuberosumSingleSGN-U256503---
ArabidopsisSingleAt1g64660 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25363)
Chromosome
1
Position
24.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41137
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
AGCGTCTGCGAAGCCACCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10349
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGTCTGCGAAGCCACCACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10350
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGTCTGCGAAGCCACCACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10351
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCGTCTGCGAAGCCACCACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12215
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12216
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500+650
Approximate temperature
55°C
  
PCR data   Exp. ID 12217
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500+800
Approximate temperature
55°C
  
PCR data   Exp. ID 12218
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12219
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500+600
Approximate temperature
55°C
  
PCR data   Exp. ID 12220
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500+600
Approximate temperature
55°C
  
PCR data   Exp. ID 12221
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12222
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12223
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12224
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12225
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 320+500
Approximate temperature
55°C
  
PCR data   Exp. ID 12226
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33325
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500+600
Approximate temperature
55°C
  
PCR data   Exp. ID 33326
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500+600
Approximate temperature
55°C
  
PCR data   Exp. ID 33327
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33328
Forward primer (5'-3')
TCCATCGAGGCCTCCGCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGGAGCAAAAGTGTTGTCCACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g64660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6950 marker 6950
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)