SGN Marker C2_At1g64770

SGN-M6951
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U199969---
Lycopersicon CombinedSingleSGN-U218865---
Solanum tuberosumSingleSGN-U256341---
ArabidopsisSingleAt1g64770 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46601)
Chromosome
3
Position
4.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46449)
Chromosome
3
Position
10.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42191)
Chromosome
10
Position
63.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43755
Forward primer (5'-3')
TCCGGAGCTGTACTTATTGCACACATC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AGCCCAAACGTATTATCCTAAAGAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41341)
Chromosome
3
Position
61.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43317
Forward primer (5'-3')
TCCGGAGCTGTACTTATTGCACACATC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AGCCCAAACGTATTATCCTAAAGAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38232)
Chromosome
3
Position
72.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39504
Forward primer (5'-3')
TCCGGAGCTGTACTTATTGCACACATC
Accessions and product sizes
Solanum lycopersicum TA209
250250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCCAAACGTATTATCCTAAAGAAGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25364)
Chromosome
1
Position
24.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g64770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6951 marker 6951
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)