SGN Marker C2_At1g64970

SGN-M6954
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198141---
Lycopersicon CombinedSingleSGN-U216662---
Solanum tuberosumSingleSGN-U248673---
ArabidopsisSingleAt1g64970 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25367)
Chromosome
1
Position
24.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41138
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
Accessions and product sizes
Solanum pennellii TA56
100
Solanum lycopersicum TA209
100
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10352
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 10353
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 10354
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12778
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12779
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12780
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12781
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12782
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12783
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12784
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1150+1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12785
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12786
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32834
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32835
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32836
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32837
Forward primer (5'-3')
AGATATTTGGGGTGACCATATGCATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACATCAACTATGGACGTTGGTTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g64970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6954 marker 6954
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)