SGN Marker C2_At1g65230

SGN-M6958
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300970 (SGN)
122476 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218059---
Solanum tuberosumSingleSGN-U253220---
ArabidopsisSingleAt1g65230 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49218)
Chromosome
4
Position
53.69 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47149)
Chromosome
4
Position
51.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41342)
Chromosome
12
Position
57.30 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43318
Forward primer (5'-3')
TTACAGGACGAGACAAGTACAAGAGACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTATAATTTGAAAACAGGGTAAAAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38234)
Chromosome
4
Position
63.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39505
Forward primer (5'-3')
TTACAGGACGAGACAAGTACAAGAGACC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TAAATCCCATTCCTCTTCATGCTCAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25371)
Chromosome
1
Position
24.23 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g65230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6958 marker 6958
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)