SGN Marker C2_At1g65700

SGN-M6964
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311108 (SGN)
131588 (CGN)
---
Lycopersicon CombinedSingleSGN-U220661---
Solanum tuberosumSingleSGN-U251127---
ArabidopsisSingleAt1g65700 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132183)
Chromosome
6
Position
125.89 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46602)
Chromosome
1
Position
110.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38237)
Chromosome
6
Position
73.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39508
Forward primer (5'-3')
TATCTCAGTTATTACAAATGATGGACGG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTTCATCTAATTCCCCAACGACGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25377)
Chromosome
1
Position
24.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g65700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6964 marker 6964
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)