SGN Marker C2_At1g67660

SGN-M6984
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U223206---
Solanum tuberosumSingleSGN-U247146---
ArabidopsisSingleAt1g67660 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38242)
Chromosome
10
Position
55.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39513
Forward primer (5'-3')
ATGAGCAATGCATGCGTTTCGAG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGCATTCCTGTTCGCAGATGGTAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25397)
Chromosome
1
Position
25.37 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10368
Forward primer (5'-3')
ATGAGCAATGCATGCGTTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCATTCCTGTTCGCAGATGGTAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10369
Forward primer (5'-3')
ATGAGCAATGCATGCGTTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCATTCCTGTTCGCAGATGGTAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10370
Forward primer (5'-3')
ATGAGCAATGCATGCGTTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCATTCCTGTTCGCAGATGGTAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10371
Forward primer (5'-3')
ATGAGCAATGCATGCGTTTCGAG
Digested band sizes (using SacI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCATTCCTGTTCGCAGATGGTAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BanII,BsiHKAI,SacI
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g67660F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g67660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6984 marker 6984
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)