SGN Marker C2_At1g67700

SGN-M6985
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U219594---
Solanum tuberosumSingleSGN-U249769---
ArabidopsisSingleAt1g67700 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49220)
Chromosome
5
Position
8.12 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47151)
Chromosome
5
Position
86.40 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46605)
Chromosome
12
Position
28.10 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42192)
Chromosome
3
Position
58.00 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43756
Forward primer (5'-3')
ACAACTGCAAAAATTATGGTTGCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCTGTTTCATTGCCAATTTCTTTAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38243)
Chromosome
5
Position
66.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39514
Forward primer (5'-3')
AAGAGGAAATTGTTAGTGGTTGAAGC
Accessions and product sizes
Solanum pennellii TA56
520
Solanum lycopersicum TA209
520
Approximate temperature
55°C
Reverse primer (5'-3')
ACTGCTGCGAGATTCCTAGCTAGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150+350
Solanum pennellii TA56
120+350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25398)
Chromosome
1
Position
25.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10372
Forward primer (5'-3')
AAGAGGAAATTGTTAGTGGTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTGCGAGATTCCTAGCTAGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
53°C
  
PCR data   Exp. ID 10373
Forward primer (5'-3')
AAGAGGAAATTGTTAGTGGTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTGCGAGATTCCTAGCTAGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
53°C
  
PCR data   Exp. ID 10374
Forward primer (5'-3')
AAGAGGAAATTGTTAGTGGTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTGCGAGATTCCTAGCTAGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
53°C
  
PCR data   Exp. ID 10375
Forward primer (5'-3')
AAGAGGAAATTGTTAGTGGTTGAAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTGCGAGATTCCTAGCTAGAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1400
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g67700F.cds.txt, plain text

Genomic location of C2_At1g67700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6985 marker 6985
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)