SGN Marker C2_At1g67730

SGN-M6986
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300528 (SGN)
123973 (CGN)
---
Capsicum annuumSingleSGN-U197944---
Lycopersicon CombinedSingleSGN-U215119---
Solanum tuberosumSingleSGN-U246038---
ArabidopsisSingleAt1g67730 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46606)
Chromosome
12
Position
28.80 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41345)
Chromosome
2
Position
141.60 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43321
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38244)
Chromosome
2
Position
143.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39515
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25399)
Chromosome
1
Position
25.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10376
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10377
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10378
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12227
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12228
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12229
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12230
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12231
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12232
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12233
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12234
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12235
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12787
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12788
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12789
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12790
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12791
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12792
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 12793
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12794
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12795
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12796
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12797
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32838
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32839
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32840
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 32841
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33329
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33330
Forward primer (5'-3')
ACCTGCTAAGAATCTTAAGAAATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATACAGAGGATCAGAGGGGATAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10379
Forward primer (5'-3')
TGGGATTGATGTGCAATGCCAGG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCAGCCCGAGCATAACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g67730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6986 marker 6986
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)