SGN Marker C2_At1g67740

SGN-M6987
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300042 (SGN)
122939 (CGN)
---
Capsicum annuumSingleSGN-U202043---
Lycopersicon CombinedSingleSGN-U213214---
Solanum tuberosumSingleSGN-U244675---
ArabidopsisSingleAt1g67740 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49221)
Chromosome
10
Position
59.32 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47152)
Chromosome
10
Position
41.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46607)
Chromosome
3
Position
52.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41346)
Chromosome
10
Position
132.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43322
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38245)
Chromosome
10
Position
43.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39516
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
Accessions and product sizes
Solanum pennellii TA56
420
Solanum lycopersicum TA209
420
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25400)
Chromosome
1
Position
25.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10380
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 370
Approximate temperature
55°C
  
PCR data   Exp. ID 10381
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 370
Approximate temperature
55°C
  
PCR data   Exp. ID 10382
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 370
Approximate temperature
55°C
  
PCR data   Exp. ID 32223
Forward primer (5'-3')
ATGTGACTCCGCATTTGCAGCTC
Digested band sizes (using Tsp509I)
Solanum lycopersicum LA925: 370
Solanum pennellii LA716: 170+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTCATCTTATTAATCTGATTCAAAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI,NheI,Tsp509I
  
Accessions and product sizes
Solanum pennellii LA716: 370
Solanum lycopersicum LA925: 370
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g67740F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g67740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6987 marker 6987
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)