SGN Marker SSR26

SGN-M699

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 55
Repeat motif: CGG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CGCCTATCGATACCACCACT
Reverse primer: ATTGATCCGTTTGGTTCTGC
Predicted size: 178
Derivations 
This marker was derived from EST read SGN-E113313
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43787)
Chromosome
2
Position
17.00 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44794
Forward primer (5'-3')
CGCCTATCGATACCACCACT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGATCCGTTTGGTTCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43247)
Chromosome
2
Position
67.70 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44608
Forward primer (5'-3')
CGCCTATCGATACCACCACT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGATCCGTTTGGTTCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39199)
Chromosome
2
Position
77.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 29
Forward primer (5'-3')
CGCCTATCGATACCACCACT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGATCCGTTTGGTTCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 179+179
Solanum pennellii LA716: 173+179
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR26 was used as an overgo probe on plate 12 [well B1]

Plausible BAC Matches:   P320N02,   P163F04,   P159I07,   P291P19,   P309I03,   P302L10,   P258H04,   P257K02,   P147J24,   P154P23,   P269J19,   P082M19

 Overgo Sequences

A sequence
CAGAACCAAACGGATCAATTTGAG
B sequence
CGCTGCGAAAATAAGCCTCAAATT
AB sequence
CAGAACCAAACGGATCAATTTGAGGCTTAT
Marker sequence
GCCGAAGCACAAACCCCATCAAACTTCTGACATCACTTTTCTCGATCCCC
CGCCTATCGATACCACCACTGTCCACTGTCCGGCGGCGGCGGCGGCGGCG
GATCACCACCTGGGATCTTCTTAAACCTCTCTAATTCTCTGCCCTATTCC
TTATCACAGATCTAATTCAGTATTCTCAAACTGATTGAATCGACTCAGTA
ATGGCTGCGCAGAACCAAACGGATCAATTTGAGGCTTATTTTCGCAGCGC
AAAGGAAGGAGACTAGTTTTGATGGTTCACCCAATGCTGCCCAAAGTGAA
CACTGGGGTACTGAATCTGTGTTCTCGAGGGATAAAGGTTTTGATGGATC
TGGCTGGGGTACATTTGATACCAACTTTGACACTGATGCTGCATGGGACG
TCAATTCTGTTGCAAAGGATTCAGATCATGACAATCTCAAGGAATCTTCT
CTTTTTGGAGATGATGATTGGGGCTTAGCCCCTATTAAAACGGGGTCCAA
ACAGTCCAACACACTACCGAATCAAATGCCATCCTTTGATTCTGTTCCTA
GCACGCCAAGTTACAATGCTGGGATAGACAACACGTTCCCCAAACAAAGC
CCTTTCTTTGATTC
Genomic location of SSR26  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D699 marker 699
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)