Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR27

SGN-M700

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: TC   Repeat number: 6
Repeat motif: ATGT   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: CCCAAATCAAGGTTTGTGGT
Reverse primer: TCAGATGCCACCACTCTCAG
Predicted size: 148
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39201)
Chromosome
3
Position
169.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 54
Forward primer (5'-3')
CCCAAATCAAGGTTTGTGGT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGATGCCACCACTCTCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 149+149
Solanum pennellii LA716: 149+161
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR27 was used as an overgo probe on plate 2 [well A2]

Plausible BAC Matches:   P274G23,   P204F22,   P315D17,   P143N09,   P167C20

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCCAAATCAAGGTTTGTGGTTTCC
B sequence
TCGAGCGACTATACAGGGAAACCA
AB sequence
CCCAAATCAAGGTTTGTGGTTTCCCTGTAT
Marker sequence
CCCATCCTTTGCGCGAAAACCCTGAAATAGAAAACGGTTTTTGGGCAAAA
CCCCAAATCAAGGTTTGTGGTTTCCCTGTATAGTCGCTCGACCTCATATT
ACATGATTTTTGGCTCTTCCTCCTCTCACTACAAATACAAAGGATGTATG
TATCTCTCTCTCTCATTTACTATATATATCTGAGAGTGGTGGCATCTGAC
GACTGCTCCAACCATGGACCTGGAAGCCGGCTCCTCCCATCTCAACTCTT
CTCCCCAACACCAC
Genomic location of SSR27  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D700 marker 700
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)