SGN Marker SSR29

SGN-M702

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 50
Repeat motif: AAG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AGTTGCTACACAGCAGCCAA
Reverse primer: AGCGATGAGACAAGAGGCAG
Predicted size: 156
Derivations 
This marker was derived from EST read SGN-E179977
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49367)
Chromosome
1
Position
78.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47302)
Chromosome
1
Position
85.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42992)
Chromosome
1
Position
36.70 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43992
Forward primer (5'-3')
AGTTGCTACACAGCAGCCAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCGATGAGACAAGAGGCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39208)
Chromosome
1
Position
91.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32117
Forward primer (5'-3')
AGTTGCTACACAGCAGCCAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCGATGAGACAAGAGGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 156
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR29 was used as an overgo probe on plate 9 [well B8]

Plausible BAC Matches:   P100H10,   P101I08

 Overgo Sequences

A sequence
AACCGATCGTAGTTGCTACACAGC
B sequence
TCTCGAGATGTTGGCTGCTGTGTA
AB sequence
AACCGATCGTAGTTGCTACACAGCAGCCAA
Marker sequence
GGGTCAAAAAAACCCCTTAAACTATCCAAAATAGCTCAAATTTACTCTTA
AACTATATTTCAAACTTAAAACTATCCTTTCTATCAAATTATTTGGTCAA
AAATATCTTTGTTATTAAGGAAAGTTTTTTAATGTCATTTTGATGTCACA
TGCCAAGTACAAATACATGGGCCTGGGAACAACGTTATGGGCCGGGTTGC
TTCAAAATAACCGATCGTAGTTGCTACACAGCAGCCAACATCTCGAGACT
TTTCTGGGTGATAGGAAATCTACGGAAAGAAGAAGAAGAAGAAGAAGAAA
AGATGGCGGTAATGGGGAAATTGAGAATGTTCGTGGTTCAAGAACCAGTC
GTGGCTGCCTCTTGTCTCATCGCTGGATTCGGTGATTCTTACTCTCTATC
TTTACGCTATCATCAAATCTTCGATTTTATGTTTGTTGGTTAAAAATAAG
TTGTTTTTTTTTCATTAGTGACAATTGAATTTTACACATAAGTTCACAAT
TTTCGAACTGTATATCGGTGGGAATCAGGCGTCCATGGACCCTATTGTGG
TTGAATCTATGAA
Genomic location of SSR29  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D702 marker 702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)