SGN Marker C2_At1g71810

SGN-M7029
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301907 (SGN)
124608 (CGN)
---
Solanum tuberosumSingleSGN-U267574---
ArabidopsisSingleAt1g71810 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46610)
Chromosome
4
Position
52.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46451)
Chromosome
4
Position
37.80 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41350)
Chromosome
4
Position
90.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43326
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38252)
Chromosome
4
Position
71.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39523
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
Accessions and product sizes
Solanum lycopersicum TA209
580
Solanum pennellii TA56
580
Approximate temperature
55°C
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
380
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25442)
Chromosome
1
Position
27.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10404
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 10405
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 10406
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 10407
Forward primer (5'-3')
TCATGCAGATCCACATCCTGGAAAC
Digested band sizes (using CfoI)
Solanum pennellii LA716: 1050
Solanum lycopersicum LA925: 350+700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGACAAAATCCTTGGCCAATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AvaII,BslI,BstUI,CfoI/HhaI,HinfI,NheI,Sau96I,StyI,TaqI,
All possible enzymes for lycopersicum and pimpinellifolium: AvaII,BstUI,CfoI/HhaI,Sau96I,StyI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1050
Solanum pennellii LA716: 1050
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g71810F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g71810F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g71810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7029 marker 7029
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)