SGN Marker C2_At1g72030

SGN-M7034
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301239 (SGN)
124474 (CGN)
---
Lycopersicon CombinedMultipleSGN-U213337---
Solanum tuberosumSingleSGN-U252524---
ArabidopsisSingleAt1g72030 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42194)
Chromosome
3
Position
65.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43758
Forward primer (5'-3')
AATTACAGTACATGATTTCATTCTCAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCACCTGAAACTACTATATAACCTGCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41351)
Chromosome
6
Position
2.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43327
Forward primer (5'-3')
AATGTTGCTGCTGTTCAAGCTGAAGC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
ATCACCTGAAACTACTATATAACCTGCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38254)
Chromosome
3
Position
52.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39525
Forward primer (5'-3')
AATGTTGCTGCTGTTCAAGCTGAAGC
Accessions and product sizes
Solanum pennellii TA56
525
Solanum lycopersicum TA209
525
Approximate temperature
55°C
Reverse primer (5'-3')
ATCACCTGAAACTACTATATAACCTGCAT
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
225
Solanum lycopersicum TA209
425
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25447)
Chromosome
1
Position
27.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g72030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7034 marker 7034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)