SGN Marker C2_At1g73820

SGN-M7043
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203492---
Lycopersicon CombinedSingleSGN-U221249---
Solanum tuberosumSingleSGN-U267031---
ArabidopsisSingleAt1g73820 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109225)
Chromosome
3
Position
56.93 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38257)
Chromosome
3
Position
76.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39528
Forward primer (5'-3')
TGTGCTCGTCGAATCAGAATCGG
Accessions and product sizes
Solanum pennellii TA56
800
Solanum lycopersicum TA209
800
Approximate temperature
58°C
Reverse primer (5'-3')
TACAACATCGAAGGGACCATCAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25456)
Chromosome
1
Position
27.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g73820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7043 marker 7043
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)