SGN Marker C2_At1g73885

SGN-M7046
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198419---
Lycopersicon CombinedSingleSGN-U215964---
Solanum tuberosumMultipleSGN-U245648---
ArabidopsisSingleAt1g73885 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41352)
Chromosome
6
Position
94.40 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43328
Forward primer (5'-3')
TGGTGCACCATCCACAAGGCCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAAAACAAATATAAGTTTTCCCTCGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38258)
Chromosome
6
Position
48.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39529
Forward primer (5'-3')
TGGTGATGCTTTTGTGATGCCGAAG
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
550
Approximate temperature
55°C
Reverse primer (5'-3')
TATGTGGCCACAGCAATACCACATGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
200
Solanum pennellii TA56
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25459)
Chromosome
1
Position
27.79 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g73885  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7046 marker 7046
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)