SGN Marker C2_At1g74470

SGN-M7049
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302617 (SGN)
123421 (CGN)
---
Capsicum annuumSingleSGN-U197706---
Lycopersicon CombinedMultipleSGN-U214067---
Solanum tuberosumSingleSGN-U244474---
ArabidopsisSingleAt1g74470 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46611)
Chromosome
3
Position
51.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46453)
Chromosome
3
Position
69.70 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38259)
Chromosome
3
Position
122.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39530
Forward primer (5'-3')
TCAACGGCTTGTTTCTCAGAATGGACA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATCCTTCAACAATTGCTTCAGCACACAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25462)
Chromosome
1
Position
28.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g74470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7049 marker 7049
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)