SGN Marker C2_At1g74520

SGN-M7050
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301586 (SGN)
124279 (CGN)
---
Capsicum annuumSingleSGN-U201989---
Lycopersicon CombinedSingleSGN-U218741---
Solanum tuberosumSingleSGN-U254549---
ArabidopsisSingleAt1g74520 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38260)
Chromosome
3
Position
113.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39531
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
Accessions and product sizes
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
390+410
Solanum pennellii TA56
1350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25463)
Chromosome
1
Position
28.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10415
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10416
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10417
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12798
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12799
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12800
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12801
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12802
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12803
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12804
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12805
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12806
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32607
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32842
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32843
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32844
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32845
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10418
Forward primer (5'-3')
ACCAAATCCCCTGTGGATGATCAG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 390+410
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAAGGTATGACCAACCAGCAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g74520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7050 marker 7050
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)